site stats

Ctcf shrna

WebDec 26, 2024 · Results: We knocked down CTCF in EL4 cells using shRNA, and conducted single cell RNA-seq on both wild type (WT) cells and CTCF-Knockdown (CTCF-KD) cells using Fluidigm C1 system. Principal component analysis of single cell RNA-seq data showed that WT and CTCF-KD cells concentrated in two different clusters on PC1, … WebNov 5, 2012 · Mutation of CTCF-binding sites in plasmid-borne promoters reduced transcriptional activity in an orientation-dependent manner. Depletion of CTCF by …

NSD2 E1099K drives relapse in pediatric acute lymphoblastic …

WebCTCF (the CCCTC-binding factor) is a sequence-specific DNA binding protein that recognizes extended DNA motifs with its 11 zinc fingers and acts as a critical regulator of interphase genome folding (Splinter et al ... (NT) shRNA. (G) Effects of 2 h of LPS stimulation on the 7543 H3K9me3 blocks methylated by SETDB1. (H) ... WebSep 1, 2016 · Our results explain how epigenetic factor CTCF-mediated chromatin remodeling regulates interactions between eye-specific PAX6 and those genes that are induced/associated with cell differentiation to modulate corneal epithelial cell-specific differentiation. ... Diminished CTCF mRNA with CTCF-shRNA in HTCE cells weakened … curlsbot test https://lomacotordental.com

Role of CCCTC binding factor (CTCF) and cohesin in the

WebNov 30, 2024 · Inhibition of cell proliferation and clonogenicity following CTCF shRNA knockdown in K562 cells. (A) Immunoblot of CTCF shRNA knockdown in the presence and absence of doxycycline (dox) compared to ... WebUsing 3C-based experiments in B cells where CTCF protein levels were downregulated by shRNA-mediated CTCF depletion or Mb1-Cre-mediated conditional deletion of the Ctcf gene in vivo, we and others have shown that in the absence of CTCF IgH locus contraction is only modestly affected (Degner et al., 2009) and Igκ long-range chromatin ... WebSep 19, 2024 · The CCCTC-binding factor (CTCF) protein and its modified forms regulate gene expression and genome organization. However, information on CTCF acetylation … curls book

CTCF siRNA (h), shRNA and Lentiviral Particle Gene Silencers

Category:SANTA CRUZ BIOTECHNOLOGY, INC. CTCF siRNA (h): sc-35124

Tags:Ctcf shrna

Ctcf shrna

DNA architectural protein CTCF facilitates subset-specific …

WebAug 23, 2013 · Lentiviral particles containing shRNA of CTCF tagged with a variant of green fluorescent protein (Turbo-GFP, Sigma-Aldrich, St. Louis, MO) were packaged in HEK-293T cells (17). The viral concentrations in the culture medium were titrated by PCR after cotransfection of HTCE cells with pCMV-VSV-G, psPAX2, and pGIPZshRNA-CTCF … WebAn unenriched total input fraction was processed for comparison. bShort hairpin mediated CTCF knockdown in two separate shRNA targeting CTCF ve rified by western blotting after 3 and 5days of shR NA induction including shRNA non-silencing contr ol (shNSC). Data shown are one representative of 3 independent experiments using immortalized HPECs.

Ctcf shrna

Did you know?

WebThe site navigation utilizes arrow, enter, escape, and space bar key commands. Left and right arrows move across top level links and expand / close menus in sub levels. WebDec 26, 2024 · Efficient CTCF knockdown and single cell RNA-seq. We knocked down CTCF in EL4 cells by short hairpin RNA (shRNA). Western blotting showed a dramatic …

WebMay 23, 2011 · At 3 d after knockdown, the percentage of viable GFP + cells was the same in the cells transduced with either control or CTCF shRNA containing retroviruses. As the cells progress through days 4 and 5, the percentage of GFP + cells drops slightly in cells in which CTCF has been knocked down. Thus, it seems that as the cells completely lose … WebSep 4, 2024 · (A) Bar chart showing the number of CTCF loops with different loop strength in control shRNA and BHLHE40 shRNA-depleted HeLa-S3 cells. ( B ) Boxplot showing …

WebApr 4, 2024 · Lentiviral shRNA constructs for CTCF and CTCF-s were obtained by cloning shRNA oligos into the pLKO.1 vector. All the shRNA … WebshRNA sequences correspond to CTCF siRNA Gene Silencer sequences After transduction, stable cell lines expressing the shRNA may be isolated via selection with …

WebApr 10, 2024 · In parallel, an unbiased in vivo shRNA screen to identify regulatory transcription factors of memory CD8 + T cell differentiation further confirmed the role of …

WebUsing 3C-based experiments in B cells where CTCF protein levels were downregulated by shRNA-mediated CTCF depletion or Mb1-Cre-mediated conditional deletion of the Ctcf … curls brand ownerWebApr 13, 2015 · B). Knockdown of CTCF with shRNA blocks viral genome amplification. CIN612 were infected with lentiviruses encoding shRNA to CTCF and after 48 hours total cell extracts were isolated and analyzed by Western blot for levels of CTCF. shRNA knockdown of CTCF blocks HPV-31 differentiation-dependent viral amplification as … curls bridal hair koreanWebMar 29, 2012 · This shRNA knockdown was confirmed by qPCR with primers specific for CTCF (Fig. 6B). Expression of CTCF shRNA resulted in a significant decrease in … curls boysWebThe site navigation utilizes arrow, enter, escape, and space bar key commands. Left and right arrows move across top level links and expand / close menus in sub levels. curls brand productscurls brand targetWebJul 20, 2024 · Using shRNA targeting CTCF to recapitulate CTCF haploinsufficiency, we have identified a novel role for CTCF in the regulation of cellular polarity of endometrial glandular epithelium. Overall, we have identified two novel pro-tumorigenic roles (promoting cell survival and altering cell polarity) for genetic alterations of CTCF in endometrial ... curls brows n braidsWebNSD2 Low cell lines were generated in these three B-ALL cell lines because they naturally harbor a heterozygous NSD2 EK mutation. More specifically, a short-hairpin RNA (shRNA: GGAAACTACTCTCGATTTATG) was used to knockdown NSD2 targeting the NSD2 Type II and NSD2 RE-IIBP isoforms both of which contain the SET domain. curls by alexion